Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3274980
End position: 3275006
Length: 27

DNA sequence
>NC_007651, from 3274980 to 3275006 (27 bp); Burkholderia thailandensis E264 GCGAGCGGCGCGAGCTGCTCGAGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3274734-3278183	Sequence	BTH_I2852 recC exodeoxyribonuclease V subunit gamma (Protein is coded in complementary strand; from 3278183 to 3274734)