Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3598781
End position: 3598807
Length: 27

DNA sequence
>NC_007651, from 3598781 to 3598807 (27 bp); Burkholderia thailandensis E264 CCGACGCGCCCGACGCGCCCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3598345-3599067	Sequence	BTH_I3156 - pyridoxamine 5'-phosphate oxidase family protein (Protein is coded in complementary strand; from 3599067 to 3598345)