Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 72531
End position: 72557
Length: 27

DNA sequence
>NC_007651, from 72531 to 72557 (27 bp); Burkholderia thailandensis E264 CGGCGGGCGCGGCGTGCGCGGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 72059-72883	Sequence	BTH_I0065 - hypothetical protein (Protein is coded in complementary strand; from 72883 to 72059)