Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 952417
End position: 952443
Length: 27

DNA sequence
>NC_007651, from 952417 to 952443 (27 bp); Burkholderia thailandensis E264 TCGCCGCGCTCGCCGCGGGCGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 951970-953025	Sequence	BTH_I0837 cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase