Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 986491
End position: 986517
Length: 27

DNA sequence
>NC_007651, from 986491 to 986517 (27 bp); Burkholderia thailandensis E264 CGTCGAGCGCATCGAGCGCGACGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 984462-986990	Sequence	BTH_I0865 - fimbrial usher protein (Protein is coded in complementary strand; from 986990 to 984462)