Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1033745
End position: 1033774
Length: 30

DNA sequence
>NC_007651, from 1033745 to 1033774 (30 bp); Burkholderia thailandensis E264 CCGCCGCGGCCGCCGCCGCCGCGGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1033736-1034104	Sequence	BTH_I0906 - lipoprotein (Protein is coded in complementary strand; from 1034104 to 1033736)