Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1227034
End position: 1227063
Length: 30

DNA sequence
>NC_007651, from 1227034 to 1227063 (30 bp); Burkholderia thailandensis E264 CGCGTCCGGCCGCGGCCGCCTGCATCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1226469-1227182	Sequence	BTH_I1085 - phosphoglycerate mutase (Protein is coded in complementary strand; from 1227182 to 1226469)