Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1227634
End position: 1227663
Length: 30

DNA sequence
>NC_007651, from 1227634 to 1227663 (30 bp); Burkholderia thailandensis E264 GCCCGCCCCCGCGGCCGCGCCCTCGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1227191-1228258	Sequence	BTH_I1086 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 1228258 to 1227191)