Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1584321
End position: 1584350
Length: 30

DNA sequence
>NC_007651, from 1584321 to 1584350 (30 bp); Burkholderia thailandensis E264 AAGCGGCCTCAAGCGACCTCAAGCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1584340-1585554	Sequence	BTH_I1407 - major facilitator superfamily transporter (Protein is coded in complementary strand; from 1585554 to 1584340)