Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1694448
End position: 1694477
Length: 30

DNA sequence
>NC_007651, from 1694448 to 1694477 (30 bp); Burkholderia thailandensis E264 CGTGCGAGTGCGAGTGCGAGTGCGAGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1694360-1695001	Sequence	BTH_I1495 ureE urease accessory protein UreE (Protein is coded in complementary strand; from 1695001 to 1694360)