Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2294663
End position: 2294692
Length: 30

DNA sequence
>NC_007651, from 2294663 to 2294692 (30 bp); Burkholderia thailandensis E264 GGGGCGCGGCCGGGTGCGGCCGGGCGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2293064-2294737	Sequence	BTH_I2024 - pseudouridine synthase family protein (Protein is coded in complementary strand; from 2294737 to 2293064)