Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2668898
End position: 2668927
Length: 30

DNA sequence
>NC_007651, from 2668898 to 2668927 (30 bp); Burkholderia thailandensis E264 TGCCGCACCGCGCCGCACCATGCCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2667446-2678398	Sequence	BTH_I2364 - peptide synthetase (Protein is coded in complementary strand; from 2678398 to 2667446)