Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 315233
End position: 315262
Length: 30

DNA sequence
>NC_007651, from 315233 to 315262 (30 bp); Burkholderia thailandensis E264 CGCATCCGCATCCGCATCCGCATCCGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 315073-315540	Sequence	BTH_I0282 - heavy metal-binding domain-containing protein