Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3215283
End position: 3215312
Length: 30

DNA sequence
>NC_007651, from 3215283 to 3215312 (30 bp); Burkholderia thailandensis E264 GCCGACGCCGACGCCGACGCCGACGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3214992-3215876	Sequence	BTH_I2799 - phosphoribosyl-dephospho-CoA transferase (Protein is coded in complementary strand; from 3215876 to 3214992)