Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3277740
End position: 3277769
Length: 30

DNA sequence
>NC_007651, from 3277740 to 3277769 (30 bp); Burkholderia thailandensis E264 AGCCGCGGCGAGCCGCGCCACGGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3274734-3278183	Sequence	BTH_I2852 recC exodeoxyribonuclease V subunit gamma (Protein is coded in complementary strand; from 3278183 to 3274734)