Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 329700
End position: 329729
Length: 30

DNA sequence
>NC_007651, from 329700 to 329729 (30 bp); Burkholderia thailandensis E264 TCACGTCACGTCACGTCACGTCACGTCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 329726-330634	Sequence	BTH_I0298 - fructokinase (Protein is coded in complementary strand; from 330634 to 329726)