Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3477226
End position: 3477255
Length: 30

DNA sequence
>NC_007651, from 3477226 to 3477255 (30 bp); Burkholderia thailandensis E264 AGGCGCGCGGCGGCGCGCGCCGGCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3476579-3477289	Sequence	BTH_I3032 - sulfite oxidase subunit YedZ (Protein is coded in complementary strand; from 3477289 to 3476579)