Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 351019
End position: 351048
Length: 30

DNA sequence
>NC_007651, from 351019 to 351048 (30 bp); Burkholderia thailandensis E264 CGCGGCGTGTTGTGGCGTGTTGCGGCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 350553-351200	Sequence	BTH_I0318 - hypothetical protein (Protein is coded in complementary strand; from 351200 to 350553)