Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3542182
End position: 3542211
Length: 30

DNA sequence
>NC_007651, from 3542182 to 3542211 (30 bp); Burkholderia thailandensis E264 GTCGGCATCGGTCGACATCGATCCGCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3541518-3545099	Sequence	BTH_I3108 - indolepyruvate ferredoxin oxidoreductase