Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3626170
End position: 3626199
Length: 30

DNA sequence
>NC_007651, from 3626170 to 3626199 (30 bp); Burkholderia thailandensis E264 GACGCGGATGCGGACGCGGACGCGGATGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3625822-3627822	Sequence	BTH_I3180 - methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 3627822 to 3625822)