Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1978718
End position: 1978750
Length: 33

DNA sequence
>NC_007651, from 1978718 to 1978750 (33 bp); Burkholderia thailandensis E264 CCGCCCCCCGTCTTCCCCCCGTCTTCCCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1978751-1979944	Sequence	BTH_I1765 - luciferase-like monooxygenase (Protein is coded in complementary strand; from 1979944 to 1978751)