Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2470893
End position: 2470925
Length: 33

DNA sequence
>NC_007651, from 2470893 to 2470925 (33 bp); Burkholderia thailandensis E264 GGATGCAAGCGGGGCGCAAGCGGGATGCAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2469107-2470912	Sequence	BTH_I2195 - dolichyl-phosphate-mannose-protein mannosyltransferase family protein (Protein is coded in complementary strand; from 2470912 to 2469107)