Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2536436
End position: 2536468
Length: 33

DNA sequence
>NC_007651, from 2536436 to 2536468 (33 bp); Burkholderia thailandensis E264 AGGCAACACCGAGGAAACACCGAGGAACCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2536388-2538358	Sequence	BTH_I2255 - poly(R)-hydroxyalkanoic acid synthase, class I