Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3701162
End position: 3701194
Length: 33

DNA sequence
>NC_007651, from 3701162 to 3701194 (33 bp); Burkholderia thailandensis E264 GAGTGCGGATGAAGTGCGAATGAAGTGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3699420-3701174	Sequence	BTH_I3246 - EmrB/QacA family drug resistance transporter