Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3744035
End position: 3744067
Length: 33

DNA sequence
>NC_007651, from 3744035 to 3744067 (33 bp); Burkholderia thailandensis E264 CCGCGATACTGTCGCGATAATGCCGCGATCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3743914-3744162	Sequence	BTH_I3288 - hypothetical protein (Protein is coded in complementary strand; from 3744162 to 3743914)