Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 310390
End position: 310424
Length: 35

DNA sequence
>NC_007651, from 310390 to 310424 (35 bp); Burkholderia thailandensis E264 TGCGAAATGCGAAATGCGAAATGCGAAATGCGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 310311-310691	Sequence	BTH_I0277 - hypothetical protein (Protein is coded in complementary strand; from 310691 to 310311)