Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1107666
End position: 1107701
Length: 36

DNA sequence
>NC_007651, from 1107666 to 1107701 (36 bp); Burkholderia thailandensis E264 CCGCTTCGACCGCTTCGACCGCTTCGACCGCTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1104089-1109443	Sequence	BTH_I0976 - cell division protein FtsK (Protein is coded in complementary strand; from 1109443 to 1104089)