Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1110686
End position: 1110721
Length: 36

DNA sequence
>NC_007651, from 1110686 to 1110721 (36 bp); Burkholderia thailandensis E264 CCGGCCGTTTCGCCGTCTGTTTCGCCGGCCGTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1110682-1112112	Sequence	BTH_I0979 purT phosphoribosylglycinamide formyltransferase 2