Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1347884
End position: 1347919
Length: 36

DNA sequence
>NC_007651, from 1347884 to 1347919 (36 bp); Burkholderia thailandensis E264 CGCACGAGCACGAGCACGAGCACGAGCACGAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1347803-1347931	Sequence	BTH_I1201 - hypothetical protein (Protein is coded in complementary strand; from 1347931 to 1347803)