Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1916919
End position: 1916954
Length: 36

DNA sequence
>NC_007651, from 1916919 to 1916954 (36 bp); Burkholderia thailandensis E264 CGCGGCGGGCGCCGGTGCGGGCGCCGCGGCGGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1915474-1918680	Sequence	BTH_I1707 - ribonuclease E (Protein is coded in complementary strand; from 1918680 to 1915474)