Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2349878
End position: 2349913
Length: 36

DNA sequence
>NC_007651, from 2349878 to 2349913 (36 bp); Burkholderia thailandensis E264 TCGCGAAAAGGATGGCGAAAAGGCGCGCAAAAAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2348755-2350278	Sequence	BTH_I2074 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 2350278 to 2348755)