Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 273021
End position: 273056
Length: 36

DNA sequence
>NC_007651, from 273021 to 273056 (36 bp); Burkholderia thailandensis E264 GGCCGGAACCCGGGCCGGGACCCATGCCGGAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 272104-273720	Sequence	BTH_I0239 flgA flagellar basal body P-ring biosynthesis protein FlgA (Protein is coded in complementary strand; from 273720 to 272104)