Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2736154
End position: 2736189
Length: 36

DNA sequence
>NC_007651, from 2736154 to 2736189 (36 bp); Burkholderia thailandensis E264 ATCCGGGTTGAAATTCGGGTTGAAATTCGGGTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2735802-2737052	Sequence	BTH_I2406 - magnesium-chelatase subunit D/I family protein (Protein is coded in complementary strand; from 2737052 to 2735802)