Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2806001
End position: 2806036
Length: 36

DNA sequence
>NC_007651, from 2806001 to 2806036 (36 bp); Burkholderia thailandensis E264 GGCGACCGGCACGACGACCGTCACGCCGACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2805816-2806850	Sequence	BTH_I2451 - hypothetical protein (Protein is coded in complementary strand; from 2806850 to 2805816)