Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2837486
End position: 2837521
Length: 36

DNA sequence
>NC_007651, from 2837486 to 2837521 (36 bp); Burkholderia thailandensis E264 ATTCACGGCCGGATTCACGGCTGAAATCGCGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2836549-2837571	Sequence	BTH_I2478 - sulfate ABC transporter permease (Protein is coded in complementary strand; from 2837571 to 2836549)