Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3214615
End position: 3214650
Length: 36

DNA sequence
>NC_007651, from 3214615 to 3214650 (36 bp); Burkholderia thailandensis E264 GTCGGTGTCGGTGTCGGTGTCGGTGTCGGTGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3213778-3214770	Sequence	BTH_I2798 citG ATP:dephospho-CoA triphosphoribosyl transferase (Protein is coded in complementary strand; from 3214770 to 3213778)