Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 409935
End position: 409970
Length: 36

DNA sequence
>NC_007651, from 409935 to 409970 (36 bp); Burkholderia thailandensis E264 GCGACCGGCGCGACCGGCGCGACCGGCGCGACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 409902-410303	Sequence	BTH_I0368 - hypothetical protein (Protein is coded in complementary strand; from 410303 to 409902)