Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 794104
End position: 794139
Length: 36

DNA sequence
>NC_007651, from 794104 to 794139 (36 bp); Burkholderia thailandensis E264 CGTGGCCGTGCGCGTGGCCGTGCGCGTGGCCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 794061-794969	Sequence	BTH_I0689 - cation ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 794969 to 794061)