Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1029708
End position: 1029747
Length: 40

DNA sequence
>NC_007651, from 1029708 to 1029747 (40 bp); Burkholderia thailandensis E264 ACGACGGACGACGACGGACGACGACGGACGACGACGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1028947-1030023	Sequence	BTH_I0902 - hypothetical protein (Protein is coded in complementary strand; from 1030023 to 1028947)