Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1141172
End position: 1141213
Length: 42

DNA sequence
>NC_007651, from 1141172 to 1141213 (42 bp); Burkholderia thailandensis E264 ACGCGCGACAGGCGACGCGCGACAGGCGACGCGCGACAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1140390-1141238	Sequence	BTH_I1004 - hypothetical protein (Protein is coded in complementary strand; from 1141238 to 1140390)