Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 153330
End position: 153374
Length: 45

DNA sequence
>NC_007651, from 153330 to 153374 (45 bp); Burkholderia thailandensis E264 CCGTCTTGCGTGCCGGCGTCTTGCGCGCGGCCGTCTTGCGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 153323-155998	Sequence	BTH_I0125 - DNA topoisomerase III (Protein is coded in complementary strand; from 155998 to 153323)