Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1552084
End position: 1552128
Length: 45

DNA sequence
>NC_007651, from 1552084 to 1552128 (45 bp); Burkholderia thailandensis E264 CTTCTGCTGTTCGAGCTTTTGTTGCTCGAGCTTCTGCTGTTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1551608-1552612	Sequence	BTH_I1374 - TolA protein superfamily (Protein is coded in complementary strand; from 1552612 to 1551608)