Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1731976
End position: 1732020
Length: 45

DNA sequence
>NC_007651, from 1731976 to 1732020 (45 bp); Burkholderia thailandensis E264 TCTTCGTCTTCGTCGTCCTCGTCTTCCTCGTCCTCTTCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1731964-1732485	Sequence	BTH_I1530 ribH 6,7-dimethyl-8-ribityllumazine synthase (Protein is coded in complementary strand; from 1732485 to 1731964)