Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2743590
End position: 2743634
Length: 45

DNA sequence
>NC_007651, from 2743590 to 2743634 (45 bp); Burkholderia thailandensis E264 TGCGTTCGCGACATGCGCGTTCGCGACATGCGCGTCCGCGACGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2742420-2743814	Sequence	BTH_I2409 - high affinity nickel transporter (Protein is coded in complementary strand; from 2743814 to 2742420)