Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3260737
End position: 3260781
Length: 45

DNA sequence
>NC_007651, from 3260737 to 3260781 (45 bp); Burkholderia thailandensis E264 TTCGACATCGCATCCTTCGACATCGCGTCGCGAGACATCGCATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3260620-3261129	Sequence	BTH_I2843 - hypothetical protein (Protein is coded in complementary strand; from 3261129 to 3260620)