Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1347883
End position: 1347930
Length: 48

DNA sequence
>NC_007651, from 1347883 to 1347930 (48 bp); Burkholderia thailandensis E264 TCGCACGAGCACGAGCACGAGCACGAGCACGAGCACGAGCACGAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1347803-1347931	Sequence	BTH_I1201 - hypothetical protein (Protein is coded in complementary strand; from 1347931 to 1347803)