Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1975863
End position: 1975916
Length: 54

DNA sequence
>NC_007651, from 1975863 to 1975916 (54 bp); Burkholderia thailandensis E264 GCGAGAACGGCGAGAACGGCGAGAACGGCGAGAACGGCGAGAACGGCGAGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1973432-1976029	Sequence	BTH_I1762 - phospholipase C (Protein is coded in complementary strand; from 1976029 to 1973432)