Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2904675
End position: 2904728
Length: 54

DNA sequence
>NC_007651, from 2904675 to 2904728 (54 bp); Burkholderia thailandensis E264 CGGGCGGCGGCGGCTCCACCTCCGGCGGCGGCTCCACCTCCGGCGGCGGCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2904290-2906023	Sequence	BTH_I2547 - hypothetical protein (Protein is coded in complementary strand; from 2906023 to 2904290)
ORF. 2904426-2906033	Sequence	BTH_I2548 - hypothetical protein