Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3259354
End position: 3259413
Length: 60

DNA sequence
>NC_007651, from 3259354 to 3259413 (60 bp); Burkholderia thailandensis E264 GCGTTAGTCGTTGCGTTAGTCGTTGCGTTAGTCGTTGCGTTAGTCGTTGCGTTAGTCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3258577-3259587	Sequence	BTH_I2841 - hypothetical protein (Protein is coded in complementary strand; from 3259587 to 3258577)