Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 658843
End position: 658902
Length: 60

DNA sequence
>NC_007651, from 658843 to 658902 (60 bp); Burkholderia thailandensis E264 GCATGTTGCCGACGCGCATGTCGCAGATGCGCACGTCGCCAACGCGCACGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 658632-659681	Sequence	BTH_I0577 pdxA 4-hydroxythreonine-4-phosphate dehydrogenase